21. Math And CS Department Department of Mathematical and Computer Sciences http://clem.mscd.edu/~math-cs/mscdmath.html

Metropolitan State College of Denver Map of the Auraria Campus DEPARTMENT OF MATHEMATICAL AND COMPUTER SCIENCES Denver, Colorado 80217 (303)-556-3208 FAX: 303-556-5381 Our Mission The Department of Mathematical and Computer Sciences is in the School of Letters, Arts and Sciences. The department provides the highest quality and most relevant Math and Computer science programs of courses through current and appropriate course content, high-level instruction, rigorous expectations of students, and accurate and valid transfer agreements. Mission and Goals Our Programs The Department offers several programs for students: In Mathematics: Mathematics - General Emphasis Mathematics - Applied Mathematics Emphasis Mathematics - Mathematics Education Emphasis Mathematics - Basic Mathematics Core Mathematics - Minor Mathematics - Probability and Statistics Emphasis Mathematics - Theoretical Mathematics Emphasis More Mathematics - General Studies: Information about general studies math courses. Other Mathematics Sites In Computer Science: Computer Science General Emphasis Computer Science MetroTech Certificate Programs Computer Science - Minor Our Courses MSCD Catalog Mathematics course descriptions Calculus Readiness Topics Sample Calculus Readiness Exam ... Class Schedules Our People Department Chair: Dr. Charlotte Murphy

22. WebMail Login WebMail is a web browserbased e-mail application which allows access to your MetroState e-mail using a common browser such as Netscape or Microsoft Internet http://webmail.mscd.edu/

Please enter your Username and Email Password, then click the Log In button below to access your Metro State e-mail. Note: Metropolitan State College of Denver does not allow its computing facilities to be used to send unsolicited e-mail. This is called SPAM mail and is against the colleges computing policies Enter Username: Enter Password: Powered by WebMail v3.61 Infinite Technologies

23. Robyn Mohr's Homepage Includes pictures of friends and family, educational history, work information and resume. http://clem.mscd.edu/~mohrr

Welcome to Robyn Mohr's Homepage Whether you're here to look at pictures, find out information on the Metro State Chemistry Department, or to just find out more information on me, I hope you enjoy your visit to my site.

24. CertCities.com | Forums: MSCD/MCAD JonathanVP, 3, 1421, 12/04/02 at 339 pm by ctpdy View Last Post. Any mscd’sout there? Nifty, 5, 1291, 11/20/02 at 605 am by Rodviking View Last Post. http://www.certcities.com/forums/display_forum_topics.asp?ForumID=14

25. Sheldon Steinhauser | Home | MSCD This web site is designed to help students, businesses and organizations learn about preventing age discrimination, successfully managing an age diverse workforce and increasing productivity by effectively utilizing older workers. http://clem.mscd.edu/~steinhas/

Courses Sociology 3040 T his web site is designed to help students, businesses and organizations learn about preventing age discrimination, successfully managing an age diverse workforce and increasing productivity by effectively utilizing older workers. Sheldon Steinhauser is associate professor of sociology at The Metropolitan State College of Denver New Best Practices Recent publications by Sheldon Steinhauser: Successfully Managing an Age Diverse Workforce Threat of Costly Age Discrimination and Older Worker Issues Gains National Attention. Age Bias : Is Your Corporate Culture in Need of an Overhaul? Cover story, HR Magazine, July 1998 Top Ten List " for Reducing, Eliminating Age Discrimination in the Workplace. Minimizing Your Potential for Age Discrimination Lawsuits Beyond Age Bias : Successfully Managing an Older Workforce Aging Today, September/October 1999

26. MSCD History 4820 Senior Seminar, Tom Altherr Spring 03 Library Instructor Linda D. Tietjen, Senior Instructor/Reference Librarian Phone303556-4298, E-mail Linda.D.Tietjen@cudenver.edu mscd HIS 4820 History http://carbon.cudenver.edu/public/library/instruction/CLASSPGS/his4820sp03.html

Where To? Home Hours Off-Campus Access ACLIN Expanded Academic Google Net Search Lexis/Nexis Prospector Search Auraria Library Skyline WebZap WorldCat HISTORY 4820: Senior Seminar Library Instructor: Linda D. Tietjen, Senior Instructor/Reference Librarian Phone: 303-556-4298, E-mail: Linda.D.Tietjen@cudenver.edu MSCD HIS 4820 : History Senior Seminar Instructor: Tom Altherr Date: Friday, February 7, 2003, 1:15 p.m. AURARIA LIBRARY HOMEPAGE The Auraria Library Homepage (http://library.auraria.edu) provides links to Skyline, the library catalog, and links to resources listed below including article indexes, full-text databases, and guides for searching the web. If Auraria Library does not own the book or periodical that you need you can order it through WebZap our Information Delivery/Interlibrary Loan service. Also, be sure to check Prospector , which will do a "global search" in the databases of Colorado academic libraries (CU-Boulder, DU, CSU, UNC, etc.) plus Denver Public Library and the Jefferson County Library system. There is a Prospector button on Skyline search screens in case our copy of a book is checked out or we do not own any books on a topic. Most of our databases can be accessed remotely 24 hours a day. Make sure you have configured your browser (a one-time task) before trying to access password protected databases. If you have not made this browser adjustment, go to: (

27. Baseball - Metro State Official baseball site with news, schedule, roster and statistics. http://www.mscd.edu/~runners/baseball/baseballhome.htm

Roadrunner Baseball - 2002 RMAC Champions 2002 All-RMAC Selections (Metro State Players Only) Brian Edwards - 1st Team All-Conference Donnie Gwinner - 1st Team All-Conference Eric Cummings - 1st Team All-Conference Steve Fox - Honorable Mention Nate Lavrenz - Honorable Mention JC Reigenborn - Honorable Mention 2002 RMAC Championship All-Tournament Team (Metro State Players Only) C - Donnie Gwinner 3B - David Dudley OF - John Burney P - Jason Richardson RP - Dan Morasci MVP - Steve Fox Men's Baseball 2003 Roster Coaches 2003 Schedule 2003 Statistics ... The Metropolitan State College of Denver Intercollegiate Athletics 303-556-8300

28. : OSM : The office also produces the annual mscd Student Handbook and provides visualdesign, photography, video and Web design services on a fee basis. http://osm.mscd.edu/

29. Basketball - Metro State Roadrunners official web site with news, schedule, roster, statistics. http://www.mscd.edu/~runners/basketball/basketballhome.htm

Roadrunner Basketball Men's Basketball Roster Coaches 2002-03 Schedule 2002-03 Statistics ... 2002 Basketball Camp Women's Basketball Roster Coaches 2002-03 Schedule 2002-03 Statistics ... The Metropolitan State College of Denver Intercollegiate Athletics 303-556-8300

30. MSCD Web supplement for the paper Differential Gene Expression Profiling of Adult MurineHematopoietic Stem Cells by InKyung Park, Yaqin He, Fangming Lin, Ole D http://db.systemsbiology.net/projects/local/stem_cell/

Web supplement for the paper " Differential Gene Expression Profiling of Adult Murine Hematopoietic Stem Cells " by: In-Kyung Park, Yaqin He, Fangming Lin, Ole D. Laerum, Qiang Tian, Roger Bumgarner, Christopher A. Klug, Kaijun Li, Christian Kuhr,Michelle J. Doyle, Tao Xie, Michel Schummer, Yu Sun, Adam Goldsmith, Michael F. Clarke, Irving L. Weissman, Leroy Hood, and Linheng Li Introduction: Method: Query: Click here to get full list of all the sequence. (Please contact Dr. Qiang Tian for the access code to open it.) By ID of the clone: Example: BA1A_21 (BA could be omitted) By txt (keyword) in the description of five best blast hits: Example: kinase By txt (sequence) in database : Example: Query="CGGCGGCAGCTCTGGCAAAGCAGCTGGAGATGAGACGTGTGCTAAGGTTGAGCGAGCTGA" Contact info: For questions related to the paper: Linheng Li , Ph.D. Assistant Stowers Scientist Stowers Institute For Medical Research lil@stowers-institute.org Or: Qiang Tian , M.D., Ph.D. Stem Cell Group The Institute For Systems Biology qtian@systemsbiology.org

31. Auraria Higher Education Center - MSCD Phone Directory .mscd Personnel AB CD EF GH IJ KL MN OP QR ST UV WX YZ .mscd Departments A to F G to L M to R S to Z . Q R. http://www.ahec.edu/phone/mscd/mscd_QR.htm

AB CD EF GH ... S to Z Q - R Name Box Number Phone/Fax Title/Department E-Mail Address QUATROCHI, Joseph MSCD, Box 25, PE-209B Ph:303 556-2898 Fax:303 556-8301 Assoc Prof HPSL quatrocj@mscd.edu QUIZAR, Robin MSCD, Box 32, KC-438 Ph:303 556-3234 Fax:303 556-6165 English quizarr@mscd.edu RAASCH, Todd MSCD, Box 9, TV-315B Ph:303 556-3832 Fax:303 556-2720 Asst Volleyball/Travel Coord raascht@mscd.edu RABINOFF, Marc MSCD, Box 25, PE-217C Ph:303 556-3935 Fax:303 556-8301 Prof HPSL rabinofm@mscd.edu RAFORTH, Karen MSCD, Box 74, TV-311A Ph:303 556-3559 Fax:303 556-8059 Assoc VP/Dean Stu Life raforth@mscd.edu RAGER, Kenneth A MSCD, Box 38, SI-317C Ph:303 556-5322 Fax:303 556-5381 Mathematical Sciences ragerk@mscd.edu RAJAGOPAL, Girijadevi MSCD, Box 52, SI-319A Ph:303 556-4449 Fax:303 556-5399 Chemistry RAMSDEN, Kurt

32. Tennis - Metro State Contains roster, coaching information, schedule, results, statistics, and allconference selections. http://www.mscd.edu/~runners/tennis/tennishome.htm

Roadrunner Tennis - 1999, 2001, 2002 RMAC Champions *2002 North Central Region Champions *2002 NCAA National Tournament Qualifier *No. 1in the North Central Region *Top 40 National Ranking in 2002 2002 RMAC Champions *2002 North Central Region Champions *2002 NCAA National Tournament Qualifier *No. 1in the North Central Region *Top 40 National Ranking in 2002 Men's Tennis Roster Coaches 2002 Sched/Results 2002 Spring Stats ... NCAA Regional Women's Tennis Roster Coaches 2002 Sched/Results 2002 SpringStats ... The Metropolitan State College of Denver Intercollegiate Athletics 303-556-8300

33. Auraria Higher Education Center - MSCD Phone Directory .mscd Personnel AB CD EF GH IJ KL MN OP QR ST UV WX YZ .mscd Departments A to F G to L M to R S to Z . http://www.ahec.edu/phone/mscd/MSCD_D_MR.HTM

AB CD EF GH ... S to Z DEPARTMENTS M - R Box Number Phone/Fax E-Mail Address Making Connections MSCD, Box 38, SI-135 Ph:303 556-5315 Fax:303 556-5381 MANAGEMENT MSCD, Box 78, WC-240 Ph:303 556-3247 Fax:303 556-8044 MSCD, Box 38, SI-141 Ph:303 556-3208 Fax:303 556-5381 MECHANICAL ENGINEERING TECHNOLOGY MSCD, Box 90, TE-124 Ph:303 556-2976 Fax:303 556-3656 MEDIA RELATIONS MSCD, Box 14, AD-560 Ph:303 556-5131 Fax:303 556-5014 Met Radio MSCD, Box 57, TV-313 Ph:303 556-3422 Fax:303 556-3421 METRO BRIDGE PROGRAM MSCD, Box 42, SF-Rm 2 Ph:303 556-3773 Fax:303 556-6053 Metro North Campus - 11990 Grant St. MSCD, Box 88, MN Ph:303 450-5111 Fax:303 450-9973 Metro South Campus - 5660 Greenwood Plaza Blvd. MSCD, Box 6, MS Ph:303 721-1391 Fax:303 220-1787 METRO STATE FOUNDATION MSCD, Box 14, AD-560

34. Volleyball - Metro State Includes news, roster, coach list, schedule, results, statistics, honors, and media guide for the Roadrunners. http://www.mscd.edu/~runners/volleyball/volleyballhome.htm

Roadrunner Volleyball - 2002 RMAC Volleyball Honors Devon Herron (1st Team All-Conference) Shawna Gilbert (1st Team All-Conference) Nicki Fusco (1st Team All-Conference) Beth Vercic (2nd Team All-Conference) Bonnie DeLaughter (RMAC Honorable Mention) Debbie Hendricks (RMAC Coach of the Year) Devon Herron (RMAC Player of the Year) 2002 Southwest All-Region Honors Devon Herron Nicki Fusco Shawna Gilbert Beth Vercic (Honorable Mention) 2002 Daktronics Southwest Region Honors Devon Herron (First Team) Nicki Fusco (Second Team) 2001 RMAC Volleyball Honors Marina Bazana (1st Team All-Conference) Devon Herron (1st Team All-Conference) Michelle McBurney (2nd Team All-Conference) Diana Marques (2nd Team All-Conference) Debbie Hendricks (RMAC Coach of the Year) 2001 Southwest All-Region Honors Marina Bazana Devon Herron Michelle McBurney 2001 Daktronics Southwest Region Honors Marina Bazana Devon Herron Women's Volleyball 2002 Volleyball Camp Runners Recruiting News Roster Coaches ... NCAA Div. II

35. MSCD Mr Scanner FCC FREQ Database Double CDRom Set (Version 4) Cat mscd34.95. New 95. An enormous amount of data! mscd 34.95. return . http://www.crbbooks.com/catalog_2_item/mscd.htm

Our Online Catalog NEW Featured Items Radio Communications Electronics Surveillance ... Our Links Return to Contact Us Ordering Info Your Cart Safe Shopping ... Your Privacy Call Us! Phone hours: 9-3 PM, M-F EST Mr Scanner FCC FREQ Database Double CD-Rom Set (Version 4) Cat # MSCD 34.95 New, double CD-Rom set includes the entire National Police Requires no installation or setup! radio code. Export data to ASC11 or DBASE files by state, city, county or service. System requirements: or higher. Runs on Windows 3.1 or Windows 95. An enormous amount of data! MSCD 34.95 return

36. Swimming/Diving - Metro State Official web site of the Roadrunners' swimming and diving teamincludes news, roster, statistics, schedule, and results. http://www.mscd.edu/~runners/swimdive/swimdivehome.htm

Men's Swimming/Diving Roster Coaches Schedule/Results Season Statistics ... NCAA Records Women's Swimming/Diving Roster Coaches Schedule/Results Season Statistics ... The Metropolitan State College of Denver Intercollegiate Athletics 303-556-8300

37. MSCD Unit Members Obtained her Ph.D. in the mscd in 2000 on the role of caspases and mitochondriain apoptotic and necrotic cell death. Ph.D. student in the mscd since 1998. http://www.dmb.rug.ac.be/u3/people/index.html

Molecular Signaling and Cell Death Group Leader Prof. Peter Vandenabeele , Ph.D. Postdoctoral Researchers Wim Declercq , Ph.D. Geertrui Denecker , Ph.D. Michael Kalai , Ph.D. Xavier Saelens , Ph.D. Geert van Loo , Ph.D. Ph.D. Students Greet Brouckaert Bart Depuydt Nele Festjens Mohamed Lamkanfi ... Maria Francisca Van Gurp Technicians Wilma Burm Jill Demeulemeester Ann Meeus Elke Van Damme ... Nancy Dhondt Master Level Students (Supervisor) Dieter Demon (M.Lamkanfi) Cindy Lauwereys (T.Vanden Berghe) Kelly Smeyers (W.Declercq Group Leader Prof. Peter V andenabeele , Ph.D. Group leader of the Molecular Signaling and Cell Death Unit History Contact tel: +32 (0)9 /264.87.64 e-mail: Peter.Vandenabeele@dmb.rug.ac.be Postdoctoral Researchers : Wim Declercq , Ph.D. Major research topics Caspase-14 History Contact tel: +32 (0)9 /264.51.44

38. Engineering Technology And Industrial Design Forward Link Offers degrees in civil, electrical, and mechanical engineering technology, surveying and mapping, industrial design, and industrial and technical studies. http://engrtec2.mscd.edu/

Click Here to Continue Click Here to Continue

39. MSCD Main Page http://www.dmb.rug.ac.be/u3/

40. The Met On-Air Roadrunners win RMAC Championship. March 9th The Men's Basketballteam takes on Fort Hays at the World Arena in Colorado Springs. http://themetonair.mscd.edu/

NEWS SPORTS CAMPUS LIFE NEWSCAST ... HOME Roadrunners win RMAC Championship March 9th - The Men's Basketball team takes on Fort Hays at the World Arena in Colorado Springs. Watch highlights and interviews from the game. QuickTime: Low High Don't Know RealPlayer: Low High Windows: Low High Cell Phone Etiquette March 7th - Cell phones are convenient, but they can also be annoying when people use them in inappropriate places. QuickTime: Low High Don't Know RealPlayer: Low High Windows: Low High Parking Refunds March 6th - What happens when you overpay for parking? Sometimes you don't get your money back right away. We take a trip to find out where to get your refund if you don't get change from the machines.

Page 2     21-40 of 108    Back | 1  | 2  | 3  | 4  | 5  | 6  | Next 20